Что такое биоинформатика.ppt
Оценка 4.9

Что такое биоинформатика.ppt

Оценка 4.9
ppt
14.05.2020
Что такое биоинформатика.ppt
Что такое биоинформатика.ppt

Что такое биоинформатика?

Что такое биоинформатика?

Что такое биоинформатика?

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции)

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции)

Что такое биоинформатика?

Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции).
Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.).
Применение компьютерных методов для решения биологических задач.
Телепатия, парапсихология, информационные поля и т.п.

?

Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции)

Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции)

Биоинформатика

Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции).
Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.).
Применение компьютерных методов для решения биологических задач.
Телепатия, парапсихология, информационные поля и т.п.

Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных

Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных

Примеры задач биоинформатики

Разработка алгоритмов для анализа большого объема биологических данных
Алгоритм поиска генов в геноме


Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами.
Изучение структуры активного центра белка


Разработка программного обеспечения для управления и быстрого доступа к биологическим данным
Создание банка данных аминокислотных последовательностей

Что понимать под биоинформатикой?

Что понимать под биоинформатикой?

Что понимать под биоинформатикой?

Как видим, смысл термина ещё ỳже...

Применение компьютерных методов для решения биологических задач

Применение компьютерных методов для решения задач
молекулярной биологии

... и еще ỳже...

Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

Итак... Биоинформатика = вычислительная молекулярная биология

Итак... Биоинформатика = вычислительная молекулярная биология

Итак...

Биоинформатика = вычислительная молекулярная биология

Почему так сузился смысл термина?

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac…

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac…

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg
ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct
ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa
gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg
ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa
agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa
attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat
aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga
gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc
tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga
acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta
cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag
ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa
aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata
cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga
gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac
tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg
acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc
tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa
acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca
ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac
ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa
actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag
gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct
ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac
ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в

В конце 1970-х годов был изобретён относительно
быстрый и дешёвый метод экспериментального определения
последовательности оснований в ДНК

Организм

ДНК «в пробирке»

Последовательность

выделение

секвенирование

...TGCCACAAATCAC...

Для хранения все возрастающей информации о последовательностях

Для хранения все возрастающей информации о последовательностях

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank

GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов

Объем GenBank’а:
1982: 680 338 букв в 606 последовательностях
1992: 101 008 486 букв в 78 608 последовательностях
2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов)
Размер файлов — 196 Gb

Пионеры биоинформатики Лайнус Полинг 1962

Пионеры биоинформатики Лайнус Полинг 1962

Пионеры биоинформатики

Лайнус Полинг

1962

Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225.

Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence
in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166.

Анализ аминокислотных последовательностей глобинов нескольких позвоночных

Гипотеза молекулярных часов

Пионеры биоинформатики Маргарет

Пионеры биоинформатики Маргарет

Пионеры биоинформатики

Маргарет Дейхофф

Однобуквенный код аминокислот
A,C,D,E,F,G,H…

Матрицы аминокислотных замен PAM (Point Accepted Mutation)

1965

Атлас последовательностей белков и их структур (1965)

Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978

Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978

Первый “банк данных”

Атлас белковых последовательностей и их структур

1965 -1978

Первая версия атласа содержала описание 65 (!) последовательностей белков

Банки данных Архивные (примеры:

Банки данных Архивные (примеры:

Банки данных

Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор
Курируемые за содержание записей отвечают специальные люди — кураторы
Автоматические записи генерируются компьютерными программами

Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www

Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www

Банк данных Swiss-Prot

1986

Swiss-Prot – база знаний о белковых последовательностях

http://www.expasy.org/sprot/

Курируемая база данных
“Золотой стандарт” аннотации

Банк данных Swiss-Prot Амос Байрох

Банк данных Swiss-Prot Амос Байрох

Банк данных Swiss-Prot

Амос Байрох

Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики

С 1987 поддерживается в сотрудничестве между

Swiss Institute of Bioinformatics (SIB)
European Bioinformatics Institute (EBI)

Банк данных Swiss-Prot Статистика роста количества документов

Банк данных Swiss-Prot Статистика роста количества документов

Банк данных Swiss-Prot

Статистика роста
количества документов

Текущий релиз 48.9 (24 января 2006) содержит 206586 документов

1986

2006

2001

Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка

Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка

Банк данных TrEMBL


Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL

Автоматическая классификация и аннотация

TrEMBL (Translated EMBL)

Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

Тенденция объединения 2002

Тенденция объединения 2002

Тенденция объединения

2002

Банк данных UniProt UniProt (

Банк данных UniProt UniProt (

Банк данных UniProt

UniProt (Universal Protein Resource)

UniProt Knowlegebase – SwissProt+TrEMBL

UniProt Archive – UniParc

UniProt Reference – UniRef

UniRef (UniProt non-redundant

UniRef (UniProt non-redundant

~2 500 000
последовательностей

компьютерный поиск гена, трансляция и компьютерная аннотация

UniRef
(UniProt
non-redundant
Reference
databases)

UniParc (UniProt Archive)

200 000 последовательностей

Экспертиза

Базы данных
научной литературы

Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586

Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586

Соотношение числа белков, представленных в разных банках

3 078 524

33 321

206 586

Последовательностей во много раз больше, чем структур!

Большинство последовательностей не аннотированы!

Документ банка данных Swiss-Prot

Документ банка данных Swiss-Prot

Документ банка данных Swiss-Prot

Описание документа: идентификатор,
имя, дата создания и модификации

Аннотация
последовательности

Последовательность

Основные поля записи SwissProt

Основные поля записи SwissProt

Основные поля записи SwissProt

ID
AC
DE
OS
OC

И сама последовательность, конечно.

Скачать файл